Σχολιασμός Βιολογίας

Δημοσιεύτηκε στις 19/06/2018    

Άλλη μια σχολική χρονιά έφτασε στο τέλος της και στο τέλος αυτής της διαδρομής το μάθημα της βιολογίας τόσο της Γενικής Παιδείας αλλά όσο και του Προσανατολισμού περίμενε τους υποωηφίους που τα επέλεξαν.

Στην Γενικής Παιδείας τα θέματα ήταν βατά ως επί το πλείστον με το Θέμα Α και το ερώτημα Β1 να αποτελούνται από εύκολα ερωτήματα πολλαπλής επιλογής και ερωτήματα σωστού-λάθους. Το υπόλοιπο ερώτημα Β ήταν ορισμοί από το σχολικό βιβλίο από τα αναμενόμενα κεφάλαια και υποκεφάλαια. Η άσκηση του τρίτου θέματος είναι τυπική του δευτέρου κεφαλαίου και στηρίζεται στον κανόνα μεταφοράς ενέργειας του 10%. Το σημείο δυσκολίας για τους υποωηφίους στο Γ ερώτημα είναι η πυραμίδα πληθυσμού που ζητήθηκε καθώς είναι ατυπική, δηλαδή δεν έχει την κλασική μορφή που συναντάει ο μαθητής στο σχολικό βιβλίο και δυστυχώς όσοι μαθητές δεν είχαν είτε την κατάλληλη προετοιμασία εξωσχολικά είτε την απαιτούμενη φαντασία δεν αναμένεται σε μεγάλο ποσοστό να το έχουν λύσει. Η πρόβλεψη που ζητήται στο Γ4 είναι εύκολη ακόμα και για μη καλά προετοιμασμένους μαθητές καθώς μπορεί να εξαχθεί και βάση της λογικής. Στην άσκηση του ερωτήματος Δ έχουμε μια τυπικότατη μόλυνση από ιό η οποία όμως ξεφεύγει από τα πλαίσια του σχολικού για κάποιον μη καλά προετοιμασμένο. Η κύρια δυσκολία του θέματος είναι ότι αν ο μαθητής δεν καταφέρει να απαντήσει σωστά στο πρώτο υποερώτημα αυτόματα χάνει όλο το θέμα καθώς τα άλλα υποερωτήματα εξαρτώνται άμεσα από αυτό.

Στον Προσανατολισμό τα θέματα ήταν απαιτητικά. Το Α4 πολλαπλής ενδέχεται να έχει 2 υποψήφιες απαντήσεις ανάλογα ποια μειωτική διαίρεση και πως θα γίνει αυτή έχει υπόψιν του ο μαθητής. Τα υπόλοιπα πολλαπλής είναι μέτριας δυσκολίας για κάποιον προετοιμασμένο. Η αντιστοίχιση του Β1 είναι εύκολη σχετικά ενώ και το υπόλοιπο ερώτημα Β είναι και αυτό μέτριας δυσκολίας. Το θέμα Γ είναι μια κλασική άσκηση μετάφρασης και μετάλλαξης αυτό όμως δεν την κάνει και εύκολη για κάποιον απροετοίμαστο. Ιδιαίτερη προσοχή θέλει το Γ4 καθώς ενώ περιγράφει μια τυπική διαδικασία εργαστηρίου αυτό δεν αναφέρεται κάπου στο σχολικό ούτε μπορεί ένας μαθητής να το εξάγει από μόνος του. Η άσκηση του Δ θέματος ήταν σίγουρα απαιτητική αφού ο μαθητής έπρεπε να πάρει περιπτώσεις για να δει τι έγινε με τις αναλογίες αλλά εφόσον τα κατάφερνε το υπόλοιπο ήταν σχετικά βατό.

Εν κατακλείδι παρατηρήται μια τάση της εξεταστικής επιτροπής να ζητάει θέματα είτε αδίδακτα από το σχολικό είτε απαιτητικά ως προς την εξαγωγή τους από τους μαθητές γεγονός που καταδεικνύει την αναγκαιότητα του εκσυγχρονισμού της ύλης και της αλλαγής του σχολικού εγχειριδίου ώστε να αποφευχθούν τέτοια συμβάντα μελλοντικά.

Κουϊμάνης Χρυσοβαλάντης

Μοριακός Βιολόγος-Γενετιστής

chkouimanis@gmail.com

6944348666

 




 

ΘΕΜΑ Α

Α1. Δ

Α2. Β

Α3. Α

Α4. Α

Α5. Β

ΘΕΜΑ Β

Β1. Γ: 1,3,5,6 Β:2,7 Α:4

Β2. Ο Β καθώς ο lactobacillusαναπτύσσσεται σε pH 4,5

B3.Χρωμοσωμική δομική μετάλλαξη στο 5ο χρωμόσωμα. Σύνδρομο φωνή της γάτας.

Β4. Ίσου μήκους: α,δ Διαφορετικού μήκους β,γ

α) οι αδερφές χρωματίδες είναι όμοιες

β)  διαφορετικά γονίδια άρα άγνωστο που θα κόcει η EcoR1

γ) διαφορετικά πλασμίδια άρα άγνωστο που θα κόψει η EcoR1

δ) Βακτηριακός κλώνος άρα το κυρίως βακτηριακό DNAείναι πανομοιότυπο

ΘΕΜΑ Γ

Γ1. Θα εργαστούμε με γονιδιωματική βιβλιοθήκη. Διότι θέλουμε να μελετήσουμε το γονίδιο και όχι απλώς το μεταφραζόμενο προϊόν. Παράθεση ορισμών γονιδιωματικής βιβλιοθήκης (σχολικό σελίδες 63-64) και cDNAβιβλιοθήκης (σχολικό σελίδα 64)

Γ2. Ελέγχουμε τα δύο γονίδια ως προς την φορά 5’-3’ ψάχνοντας την τριπλέτα ATGκαι κάποια από τις αλληλουχίες λήξης απαραίτητα με βήμα τριπλέτας. Και τα 2 γονίδια που παρατίθενται είναι 3’-5’

Γονίδιο α

ATAAGTACCGGGGCCGTATAA

3’ ATAAGT/ACC/GGG/GCC/GTATAA 5’ μεέντονα τα κωδικόνια έναρξης λήξης

Γονίδιοβ

ATAAGTACCGGΤGCCGTATAA

3’ ATAAGT/ACC/GGΤ/GCC/GTATAA 5’ μεέντονα τα κωδικόνια έναρξης λήξης

Θα παραχθούν πεπτίδια και από τις δύο αλυσίδες εφόσον κατά την φορά 5’-3’ συναντούμε κωδικόνιο έναρξης (ATG) και λήξης (TGA) και απέχουν μεταξύ τους με βήμα τριπλέτας.

Το κανονικό αντικωδικώνιο 3’CCC5’ ενώνεται με τριπλέτα του mRNA 5’GGG3’ και μεταφέρει το αμινοξύ γλυκίνη (gly). Toμεταλλαγμένο 3’CCA5’ ενώνεται με τριπλέτα του mRNA5’UGG3’ και μεταφέρει επίσης γλυκίνη.

Επομένως τα παραγόμενα πεπτίδια είναι τα εξής:

α. Met-Pro-Gly-Pro

β. Met-Pro-Trp-Pro

Γ3. Η EcoR1 αναγνωρίζει την αλληλουχία 5’GAATTC3’ με τον συπληρωματικό της κλώνο και κόβει τους δεσμούς μεταξύ Gκαι Aκαι στους δυο κλώνους. Επομένως κόβει μέσα στο γονίδιο της Τετρακυκλίνης.

Αρχικά μετά τον μετασχηματισμό πρέπει να προσθέσουμε στο θρεπτικό υλικό αμπικιλίνη ώστε να απαλλείψουμε όσα δεν μετασχηματίστηκαν. Κατόπιν καλλιεργούμε τα κύτταρα σε στερεό θρεπτικό υλικό και από τις δημιουργούμενες αποικίες παίρνουμε δείγμα για ανακαλλιέργεια σε μέσο που φέρει τετρακυκλίνη. Σε όσες καλλιέργειες το δείγμα δεν αναπτυχθεί φέρουν το μετασχηματισμένο πλασμίδιο και όσες αναπτυχθούν φέρουν το πλασμίδιο που δεν έγινε μετασχηματισμός.

ΘΕΜΑ Δ

Δ1.α) Παρατηρούμε αναλογίες 1:1 οπότε πρέπει να διερευνηθούν οι περιπτώσεις:

  1. Τόσο το χρώμα όσο και το μήκος ουράς να έιναι αυτοσωμικά (ΑΛΛΑ σε διαφορετικά χρωμοσώματα ώστε να ισχύει ο νόμος του Mendelπερι ανεξάρτητης μεταβίβασης γονιδίων)
  2. Το χρώμα να είναι σε αυτοσωμικό και το μήκος να είναι φυλοσύνδετο
  3. Το χρώμα να είναι φυλοσύνδετο και το μήκος να είναι αυτοσωμικό

β) Ο θηλυκός γονέας σύμφωνα με τις ανωτέρω περιπτώσεις μπορεί να έχει τους εξής γονότυπους:

  1. ΜμLlMμαύρο μ άσπρο Lμακριά ουρά lκοντή ουρά
  2. ΜμΧLXl
  3. LlXMXμ

γ)

  1. ΜμLl   Χ   μμll
  2. ΜμΧLXl X     μμΧLY
  3. LlXMXμ X     llXμΥ

 

Δ2. Φυσιολογικό άτομο 4 αλυσίδες. Ο άντρας φέρει 3 αλυσίδες και η γυναίκα περιπτώσεις 1) από ένα α γονίδιο σε κάθε ομόλογο χρωμόσωμα 2) 2 α γονίδια στο ένα χρωμόσωμα και κανένα στο άλλο. Η περίπτωση 1 αποκλείεται αφού το παιδί έχει ένα γονίδιο (από τον πατέρα).

Η πιθανότητα να γεννηθεί φυσιολογικό το παιδί δηλαδή να πάρει και από τους δυο γονεις το ομόλογο χρωμόσωμα με τα 2 α γονίδια είναι ½ Χ ½ = 1/4 . Ο μαθντής μπορεί φυσικά να λύσει και τετράγωνο του Punnet .

Δ3. Το Πρώτο φυτό παράγει γαμέτες 1bt 4 και 1 4 ενώ το Δεύτερο παράγει 1 4bt και 14

Γαμέτες

1bt 4

1 4

1 4bt

1bt1 4bt4

11 4bt4

14

11bt 44

11 44

Παρατηρούμε δηλαδή ότι 3 στους 4 απογόνους φέρουν το γονίδιο οπότε το ποσοστό είναι 75%.

 




 

ΘΕΜΑ Α

Α1. Α

Α2. Γ

Α3. Α

Α4. Γ

Α5. Δ

ΘΕΜΑ Β

Β1.

Α Λάθος

Β Λάθος

Γ Σωστό

Δ Σωστό

Ε Σωστό

ΣΤ Λάθος

Β2.

Α. Σχολικό σελίδα 71

Β. Σχολικό σελίδα 88

Β3.

Σχολικό σελίδες 101-102

Β4.

Σχολικό σελίδες 145-146

Β5.

Σχολικό σελίδα 86

ΘΕΜΑ Γ

Γ1. Σχολικό σελίδες 71-72

Α. Αυτότροφο

Β. Ετερότροφο

Γ. Ετερότροφο

Δ. Αυτότροφο

Γ2. Τροφική Αλυσίδα

Βελανιδιά -> Φυτοφάγα έντομα -> Κοτσύφια -> Ψείρες

Γνωρίζουμε ότι ταΦυτοφάγα έντομα έχουν βιόμαζα 100kgκαι με τον κανόνα μεταβίβασης του 10% από τροφικό επίπεδο σε τροφικό επίπεδο (σελίδα 77 σχολικού) προκύπτει

Βελανιδιά

:

1000kg

Φυτοφάγα έντομα

:

100kg

Κοτσύφια

:

10kg

Ψείρες

:

1kg

 

Πυραμίδα Βιόμαζας:

 

 

Γ3. Πυραμίδα πληθυσμού:

 

Βάρος κοτσυφιού= Βιόμαζα κοτσυφιών / άτομα πληθυσμού = 10kg/100 άτομα =>

Βάρος κοτσυφιού= 0,1kg

Γ4. Μετά από δραματική μείωση του πληθυσμού των κοτσυφιών αναμένεται ο πληθυσμός των φυτοφάγων εντόμων να αυξηθεί υπέρμετρα καθώς οι θηρευτές του έχουν μειωθεί δραματικά. Αυτό θα έχει ως αποτέλεσμα η βιόμαζα της βελανιδιάς να μειωθεί σε πολύ σημαντικό βαθμό καθώς ο αυξημένος πληθυσμός των εντόμων θα έχει και αυξημένες ανάγκες για τροφή.

 

ΘΕΜΑ Δ

Δ1. Το αντιγόνο είναι ιός διότι παρατηρούμε αύξηση όλων των καμπυλών μετά την μόλυνση συνεπώς και των ιντερφερονών. Οι ιντερφερόνες σχετίζονται αποκλειστικά με την παρουσία ιού. (Ιντερφερόνες σελίδα 34 σχολικού βιβλίου)

Δ2. Δομή ιού σχολικό σελίσα 18

Δ3. Η καμπύλη α αντιστοιχή στο αντιγόνο διότι όπως φαίνεται και στο διάγραμμα αρχίζει από το 0 και αυξάνεται ακριβώς μετα την χρονική στιγμή που συμβαίνει η μόλυνση.

Η καμπύλη γ αντιστοιχεί στα αντισώματα εφόσον γνωρίζουμε από τα δεδομένα ότι είναι πρώτη επαφή με το συγκεκριμένο αντιγόνο επομένως χρειάζονται κάποιο διάστημα  μέχρι να τα δημιουργήσει ο οργανισμός

Η καμπύλη β είναι οι ιντερφερόνες διότι προϋπήρχαν σε κάποια συγκέντρωση στον οργανισμό πριν την μόλυνση (ως μηχανισμός ΜΗ ειδικής άμυνας) ενώ μετά την μόλυνση αυξάνεται κατά πολύ η συγκέντρωσή τους ώστε να συνδράμουν στην καταπολέμηση του αντιγόνου.

Δ4. Τα κύτταρα είναι τα μακροφάγα. Ο μηχανισμός δράσης είναι στο  σχολικό σελίδα 37

Δ5. Τα κύτταρα ειδικής άμυνας που θα παραχθούν με σκοπό να δράσουν σε επανέκθεση στο ίδιο αντιγόνο είναι:

  • Τ βοηθητικά κύτταρα μνήμης
  • Τ κυτταροτοξικά κύτταρα μνήμης

 

 

 

 

 

 

 

 

 

 

 

 

 

 

TAGS